Preguntas sobre la mecánica del algoritmo de búsqueda y su implementación. * NO * para preguntas sobre el uso de herramientas de búsqueda dentro de una API (por ejemplo, Google, Bing, Facebook).

search...

Difícil de explicar, así que pondré un ejemplo a continuación: res = { "merchantPermissionsMap" : { "33427" : ["AAA", "BBB", "CCC"], "12345": ["AAA", "CCC"], "67890": ["BBB"] } } Entonces necesito buscar res['merchantPermissionsMap'] para cualquier ocurrencia de un permiso, y si lo ....
18 ago. 2020 a las 09:43
Me gustaría encontrar en un archivo grande todas las líneas, que contienen una cadena y permiten que UN carácter en mi cadena sea diferente y aún así lo considere una coincidencia. Por ejemplo tengo este archivo: >1 agctcaTATAAGtataagctagaagta >2 gatgctagcgaagtaatgc >3 atatagcgctagagccgtagta >4 gcta....
15 ago. 2020 a las 13:13
A veces me encuentro queriendo reemplazar solo 2-3 palabras largas en un programa y me resulta un poco doloroso cómo lo hago, solo me pregunto si hay algún asistente de Vim que pueda brindarme una forma más rápida de hacer esto: var_wanted = {} some_other_var = {} def function1(): .... .... s....
7 ago. 2020 a las 21:25
Al iterar a través de un archivo y buscar ocurrencias de algunas palabras en un archivo. Escribí comprensión de listas para tratar de almacenar palabras coincidentes en una lista para cada línea leída. search_strings = ["happy", "sad", "between"] fio = open("text.txt", encoding="utf-8") # reading fi....
3 ago. 2020 a las 00:29
¡Soy nuevo en ElasticSearch! Tengo una eShop (usando Laravel) con más de 1,000,000 de productos y cada producto tiene algunas propiedades en la tabla product como nombre, descripción, precio, ... y algunas otras propiedades en otras tablas como categories, options, tags, addresses, rating, brands, .....
1 ago. 2020 a las 13:23
Traté de imprimir la palabra que contiene nuestro patrón con la posición. Traté de usar una variable booleana para verificar si el texto coincide si coincide y luego se imprime pero no funciona. ¿Cómo puedo imprimir el texto con la posición? Si la Pating String está en el texto de la cadena, entonce....
29 jul. 2020 a las 08:31
¿Cómo puedo crear un bucle para que busque cada "the" en un archivo .txt y luego lo capitalice? Obtengo completamente la parte en mayúscula, pero tengo problemas para buscar cada "the" en un archivo. Mi estrategia era verificar if index[x] == "the" y hacer x += 1 al final de un ciclo, pero el proble....
27 jul. 2020 a las 12:49
Estoy tratando de implementar un equivalente a una función ctrl + F en mi proyecto. Quiero que funcione como en un Excel donde el cursor apunta a la cadena correspondiente en cualquier celda. También puede funcionar como un filtro que solo muestra las filas con la cadena correspondiente. EDITAR 1: E....
27 jul. 2020 a las 10:38
Soy nuevo en Python. Quiero escribir un algoritmo de búsqueda que pueda lograr lo siguiente: dado un punto → buscar un punto cercano que satisfaga una determinada condición → usar ese nuevo punto para buscar el siguiente nuevo punto cercano → repetir esto hasta que no se pueda encontrar un nuevo pun....
26 jul. 2020 a las 15:45
Puedo hacer una búsqueda de una sola palabra en cada columna, pero no puedo buscar el número de búsqueda de cadenas proporcionado por el usuario con la opción "y" o " 0 1 3 4 0 [OH-] [Na+] NAN CCO 1 [OH-] [Na+] CCO Cl Esta funciona....
26 jul. 2020 a las 03:40
Para cada elemento en dictA, quiero buscarlo en dictB, si dictB lo tiene, quiero extraer algunos otros valores de dictB y agregarlo a dictA. Aquí hay un ejemplo que está funcionando, sin embargo, es bastante lento, ya que tengo más de 50,000 elementos para buscar y realizará esta función similar en ....
24 jul. 2020 a las 04:21
Estoy usando la biblioteca arimorty / floatingsearchview para la barra de búsqueda y funciona bien, pero ahora quiero un icono de notificación con un círculo o placa roja sin contar, pero no puedo encontrar la manera de hacerlo. En actividad: <com.arlib.floatingsearchview.FloatingSearchView ....
23 jul. 2020 a las 17:14
Estoy tratando de buscar una cadena de vectores para ciertas palabras. Por ejemplo, vector<string> sentences = ["This is a test string","Welcome to C++!"]; string searchString = "This"; Lo intenté if (std::find(sentences.begin(), sentences.end(), searchString) != sentences.end()) { cout << "Fou....
21 jul. 2020 a las 13:32
Estoy creando la aplicación, pero tengo una pregunta. El cliente escribe el nombre del usuario en el cuadro de texto, ejemplo 3 letras y busca en la base de datos (acceso) y agrega la base de datos. Ejemplo: Usuario: Rui. y busque en la base de datos todo el nombre de usuario "Rui". //libraries usin....
18 jul. 2020 a las 20:51
¿Alguien sabe cómo garantizar que podamos devolver el resultado normal y el conjunto de resultados acentuados a través del filtro de búsqueda azul. Por ejemplo, la siguiente consulta de filtro en la búsqueda de Azure devuelve un nombre llamado unicornio cuando verifico el registro con el nombre unic....
17 jul. 2020 a las 18:09
Tengo una advertencia que aparece en la consola de Chrome Devtools: Warning: Cannot update during an existing state transition (such as within `render`). Render methods should be a pure function of props and state. in div (at Search.jsx:37) in Search (at pages/index.jsx:79) in main (crea....
15 jul. 2020 a las 17:21
Tengo una lista: list = ['United Kingdom', 'Berlin', 'italy'] Y un DataFrame: location 0 London, United Kingdom 1 BerlinGerman 2 Rome,Italy Entonces, lo que necesito hacer aquí es crear una nueva columna en el marco de datos que solo consista en la palabra en la lista. Entonces la nueva colu....
14 jul. 2020 a las 13:49
Lo que me gustaría hacer es leer el archivo como el siguiente y guardar todos los nombres de funciones en una matriz usando expresiones regulares. Los nombres de las funciones que me gustaría guardar serían 'firstCall', 'SecondCall'. He probado el patrón regex y parece estar funcionando. Pero el p....
14 jul. 2020 a las 05:45
Mi matriz de cadenas es así: string[] headers = {"Row Nr", "StartDate", "StartTime", "Q_1", "Q_96"}; ¿Cómo puedo encontrar el elemento en la matriz, que contiene mi término de búsqueda "fecha"? Sé cómo encontrar un elemento cuyo valor es igual a mi término de búsqueda, así: var match = headers.Firs....
12 jul. 2020 a las 13:25
**I want to search a tag like below** search_query = request.GET.get('query', None) # via this method, I can get some page instances which title or intro contain search_query keyword search_results = ProductionPage.objects.live().search(search_query) ¿Hay alguna forma de obtener resultados donde se....
11 jul. 2020 a las 11:58
Me dan este conjunto de código y necesito completarlo con algún código sobre el bucle while y en el bucle While. He visto algo de documentación, pero todo lo que he visto son métodos de búsqueda con dos argumentos y este solo tiene uno. Ya escribí la parte dentro del ciclo while pero estoy seguro de....
10 jul. 2020 a las 22:44
Tengo un diccionario que contiene una clave con una lista de valores que son cadenas. d = {'docs':['1_a', '2_a', '3_b', '4_c', '4_d']} Me gustaría filtrar d['docs'] con una lista de filtros como ['a', '4'], para que obtenga: ['1_a', '2_a', '4_c', '4_d'] La lista de filtros podría tener numerosas p....
9 jul. 2020 a las 16:13
Por ejemplo, si tengo: class person: def __init__(self, name, age, address=None): self.name = name self.age = age self.address = address person1 = person("Julie", 32) person2 = person("Jack", 41) person3 = person("John", 28) Quiero saber qué persona tiene 32 años. ¿Hay ....
9 jul. 2020 a las 06:05
Entonces tengo este código que básicamente está tratando de encontrar el número más grande en una matriz y el número más pequeño (aquí es el precio del boleto). Pero me encuentro escribiendo dos para bucles, me preguntaba si había una manera más eficiente de escribir esto. /** Setting cheapestCo....
8 jul. 2020 a las 06:52
Aquí está la MWE: #!/usr/bin/perl use utf8; use strict; use warnings; use Net::IMAP::Client; use Encode qw/decode/; use open ':std', ':encoding(UTF-8)'; my $user = 'my-user@gmail.com'; my $pwd = 'secret'; my $imap = Net::IMAP::Client->new( server => 'imap.gmail.com', user ....
7 jul. 2020 a las 23:31