AWK es un lenguaje de programación interpretado (AWK significa Aho, Weinberger, Kernighan) diseñado para el procesamiento de texto y generalmente se utiliza como una herramienta de extracción de datos y de informes. AWK se usa en gran medida con sistemas Unix.

awk...

Ubuntu 16.04 Bash V 4.4 Aquí está mi archivo: 4u76kumtstring5="${ThisLine__4u76kumtstring5}" # this vreis ethees 445h45thb ervexplanation forevrev wevdssdstring6="${ThisLine__wevdssdstring6}" # this is theerve explanationver for wevdssdstring6 kj rjjstring7="${ThisLine__rjjstring7}" # thise isder e....
18 jun. 2020 a las 16:09
Quiero verificar si dos campos en un campo tienen caracteres comunes first second // looking for "s" third fourth // looking for "t" or "h" or "r" some that Quiero imprimir solo las dos primeras líneas en las que los campos tienen al menos un carácter común. Leo los campos como awk 'BEGIN{FS=" ";} ....
awk
15 jun. 2020 a las 22:33
Tengo un archivo que se ve así: abc \ d \ efgh \ i jklmnop \ q \rst \ uv wx y \ z Para cada grupo de líneas consecutivas que tienen una barra invertida al final, quiero organizar esas barras invertidas en una línea vertical recta. Entonces, el resultado esperado para la muestra anterior es: ....
awk
15 jun. 2020 a las 20:15
Mi objetivo es modificar solo la línea que comienza con datos, de los cuales solo hay uno. En esta línea, estoy reemplazando los 51-80 caracteres y los 97-126 caracteres. Preferiría tener un forro con sed porque entonces puedo usar la bandera -i y luego guardaría el archivo a pedido. Aquí está la lí....
13 jun. 2020 a las 19:35
Tengo un archivo que tiene el siguiente formato [/Experiment/Run Parameters/Digitizer_0/CAEN_x725_x730_Settings/Channel_1/DPP_PSD_Params] Short_Gate = WORD : 30 Long_Gate = WORD : 100 Gate_Offset = WORD : 32 [/Experiment/Run Parameters/Digitizer_0/CAEN_x725_x730_Settings/Channel_2/DPP_PSD_Params] S....
11 jun. 2020 a las 20:45
¿Hay alguna manera de extraer por separado líneas con valores similares y guardarlas por separado? mi archivo es el siguiente 319 Eukaryota;Alveolata;Apicomplexa;Aconoidasida;Piroplasmorida;Babesia;Babesia;Babesia_canis_canis;AY072926.1.1714; 88e823b2-69c5-4be5-9338-f5ce58c41ae0 443 Eukaryota;Alv....
11 jun. 2020 a las 10:28
Tengo varios archivos en el directorio de archivos Record: Record 1.txt 2.txt 3.txt El archivo 2.txt contiene una cadena abcd en la segunda columna de la primera línea. ¿Cómo puedo imprimir todo el contenido en 2.txt? ¿Cómo puedo eliminar el archivo 2.txt? Usé awk para imprimir todos los c....
10 jun. 2020 a las 15:04
Tengo un archivo de texto con un número aleatorio de líneas. Las líneas se ven así: neededLine [text1] sometext [text2] sometext [text3] sometext [text4] sometext [text5] sometext [text6] neededLine [text7] sometext [text8] sometext [text9] Tengo un comando grep en shell, que toma líneas con la pal....
10 jun. 2020 a las 13:29
Quiero comparar la primera columna de un archivo con todas las columnas del segundo archivo y si se encuentran coincidencias, imprima la primera columna (primer archivo) y la fila completa donde se encontraron coincidencias en el segundo archivo. Ejemplo de archivo de entrada_1 RAM_1 RAM_2 RAM_3 RAM....
10 jun. 2020 a las 09:53
Por ejemplo, si no hay n líneas, se debe crear n-1 no de archivos. Esto es lo que he logrado hasta ahora. Estoy insertando manualmente 8 (es decir, no total de líneas). No sé cómo obtener el número total de líneas en una variable y luego usarlo. awk '{if (NR<8) F=NR".ndjson"; print >> F; close (F)}'....
9 jun. 2020 a las 15:41
Estoy tratando de imprimir solo la primera coincidencia de la expresión regular (foo.*bar.*zoo) junto con el resto del contenido del archivo / variable. Es necesario ignorar todas las ocurrencias de esta expresión regular, excepto primero. Aquí hay una entrada reducida y algunos de mis intentos de g....
8 jun. 2020 a las 17:31
Recientemente he estado trabajando en algunas tareas de laboratorio y para recopilar y analizar bien los resultados, preparé un script bash para automatizar mi trabajo. Fue mi primer intento de crear tal script, por lo tanto, no es perfecto y mi pregunta está estrictamente relacionada con mejorarlo.....
7 jun. 2020 a las 16:46
Sé que preguntas similares se han respondido muchas veces en SO. (un ejemplo es here: https://stackoverflow.com/questions/7846476/replace-column-in-one-file-with-column-from-another-using-awk) Pero, esto es algo único en mi caso, ya que necesito cuidar un patrón particular. El encabezado de mi archi....
6 jun. 2020 a las 16:01
Tengo un archivo de texto como el siguiente donde hay dos columnas entre cadenas: 1 23 2 29 3 21 4 18 5 19 6 18 7 19 8 24 Cluster analysis done for this configuration! 1 23 2 22 3 19 4 18 5 23 6 17 7 19 8 31 9 21 10 27 11 19 Cluster analysis done for this confi....
5 jun. 2020 a las 19:32
Los detalles del alumno se almacenan en un sistema de archivos de la siguiente manera: Roll_no,name,socre1,score2 101,ABC,50,55 102,XYZ,48,54 103,CWE,42,34 104,ZSE,65,72 105,FGR,31,45 106,QWE,68,45 Q.Escriba el comando unix para mostrar Roll_no y el nombre del estudiante cuyo puntaje total es may....
5 jun. 2020 a las 18:43
Necesito obtener el recuento de A-Z y a-z de la columna 18 de un archivo muy grande. Aquí está mi solución actual. Esta solución funciona, pero llevaría horas ya que esto requeriría 52 bucles sobre el archivo enorme. Para evitar el bucle múltiple, podría crear 52 comprobaciones para cada uno de A-Z ....
5 jun. 2020 a las 05:22
Tengo un solo archivo de columna. A A A B B B C C D Quiero usar este archivo y quiero crear uno nuevo como se muestra a continuación command="A" "B" "C" "D" TYPE=1 1 1 2 2 2 3 3 4, Estos A B C D son alfabetos aleatorios y varían de un archivo a otro. Traté de superar la solución con el siguiente s....
4 jun. 2020 a las 21:43
Tengo alrededor de 2000 archivos que tienen un número aleatorio de columnas en cada archivo. Quería eliminar las últimas 4 columnas de cada uno de los archivos. Intenté usar el siguiente comando, pero no es un comando en línea. El delimitador del archivo es # awk -F"#" '{NF-=4;OFS="#";print}' test >....
2 jun. 2020 a las 17:19
En una pequeña secuencia de comandos bash, simplemente trato de recortar los datos de entrada del GPS para que tenga valores de longitud y latitud en variables separadas: echo $geo_data GPS_latitude=$( echo $geo_data | awk -F"+|-" '{print substr($0,index($0,$2-1),1) $2}' ) GPS_longitude=$( ech....
31 may. 2020 a las 17:11
Estoy tratando de extraer tres columnas de un archivo de texto que se ve así: <Record type="HKQuantityTypeIdentifierHeartRate" sourceName="Michael’s Apple Watch" sourceVersion="6.2.5" device="&lt;&lt;HKDevice: 0x2877dc870&gt;, name:WHOOP 3A020013, manufacturer:WHOOP Inc., localIdentifier:80A56B86-0D....
30 may. 2020 a las 21:19
Tengo un CSV con muchas columnas y filas. La columna 4 tiene algunas cadenas y otras no. Cuando intento filtrar duplicados, elimina los que quiero conservar. Cuando corro: awk -F ',' '!seen[$4]++' oldfile.csv > newfile.csv En 71523180,PRASAD JAMES ANAND, ,#3 ALEX BOYD LINK HILLSBORO 71523190,PRASA....
30 may. 2020 a las 01:28
Hay un archivo FASTA assembly.fasta que contiene nombres de contig y las secuencias correspondientes: >contig_1 CCAATACGGGCGCGCAGGCTTTCTATCGCGCGGCCGGCTTCGTCGAGGACGGGCGGCGCA AGGATTACTACCGCAGCGGC >contig_2 ATATAAACCTTATTCATCGTTTTCAGCCTAATTTTCCATTTAACAGGGATGATTTTCGTC AAAATGCTGAGGCTTTACCAAGATTTTCTACCTTG....
28 may. 2020 a las 16:59
Tengo un archivo que no quiere estropear la secuencia, así que estoy tratando de resolver mi declaración condicional awk. Si $ 3 tiene TB (cadena), elimínelo y multiplíquelo por 1024 y si tiene GB simplemente quítelo (elimine la cadena GB) y no haga nada. sast1sis01_002 iresas-p2-ris03 1....
awk
28 may. 2020 a las 15:41
Al final de la tercera columna hay tres números que comienzan con 1.0, ¿cómo puedo imprimir todas las filas desde el principio hasta que se encuentre el primero de estos tres números (en negrita a continuación)? ¿Existe una solución simple de una línea con awk o sed? -80.2743682 -8.6420053 ....
28 may. 2020 a las 09:05
Tengo debajo el archivo csv de muestra. Necesita eliminar las últimas palabras después de .com en la primera columna (Host). Si hay algún número en la primera columna (host), ese número debe imprimirse en la segunda columna (puerto). Eliminar http // y https: // El archivo completo es de casi 12 KB,....
27 may. 2020 a las 02:58